go2biotech – Reagents and instruments for immunology, cell biology and molecular biology.

Catalog number / packaging

 Manual Inquire

• Description
  TIANSeq Dual-Index Adapter (Illumina) is a DNA adapter developed specifically for the Illumina high-throughput sequencing platform. lt can be used for the construction of DNA and RNA libraries. The product is available in four packages, each package provides 24 types of adapters. In total, 96 types of adaptors are available. Each adaptor has two 8-base index sequences (barcode) to allow differentiation between samples when sequencing multiple samples together. This kit provides 15 μM adaptors, and the input volume should vary depending on the kit used for library construction, initial DNA input and fragment size. Please refer to the product manuals for details. In addition, the index sequences of the 96 adaptors are listed in the adaptor sequence section.
  
• Product features
  ■Easy to choose: The adaptors are divided into four groups: 4995263, 4995264, 4995265, 4995266, to provide maximum of 96 dual-index labeling to choose, according to different experiment needs.■ Easy to use: The kit contains diluent buffer that is highly stable and can be directly used to dilute adaptor solutions.■ Quality control: Strict quality control and functional verification are applied for each batch to ensure adaptors to maintain the accurate sequences.
  
• Adaptor SequenceThe adaptor sequence includes the following information:
  1. D5XX Sequence5’ -AATGATACGGCGACCACCGAGATCTACAC[D5XX]ACACTCTTTCCCTACACGAC GCTCTTCCGATCT-3’2. D7XX Sequence5’ -GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[D7XX]ATCTCGTAT GCCGTCTTCTGCTTG -3’

TIANSeq Dual-Index Adapter (Illumina)

All trademarks or registered trademarks appearing on this website are the property of their respective owners

This product is for scientific research use only. Do not use in medicine, clinical treatment, food or cosmetics.

Need more info ? Contact us anytime. We’re here:
Go2biotech
E-mail: maggie@go2biotech.com / morgan@go2biotech.com
Telephone:+86 755 8399 5017
Address: Rm 4L, Golden Century Building, Shennan Av. 6033#, Shenzhen, China