Talent qPCR PreMix (SYBR Green) Tiangen GFP209 ( Go2biotech.com – Distribution for Reagents and instruments )
Good resistance to impurity interference and rapid quantification of complex templates
Talent qPCR PreMix (SYBR Green) Tiangen GFP209 Catalog number / packaging
Mat. No | Ref. No | No. of preps |
4992866 | GFP209-03 | 20 µl×5000 rxn |
4992775 | GFP209-02 | 20 µl×500 rxn |
4992882 | GFP209-01 | 20 µl×125 rxn |
Storage
Store at -20℃.
Description
This product is a special reagent for Real-Time PCR using SYBR Green I chimeric fluorescence. The 2×Talent qPCR PreMix adopts antibody-modified Anti Taq DNA polymerase, and the unique qPCR Buffer system can ensure the product to carry out highly sensitive and fast qPCR reaction on all Real-Time PCR instruments. The qPCR reaction time can be shortened by 50%. In addition, the addition of H-Competitor factor and EP component in Buffer makes the product have a wide range of sample universality. It has very good applicability to templates with complex advanced structures, templates with more PCR inhibitor residues, long fragment amplification, etc.
The product also has the characteristics of high amplification rate, high amplification specificity, wide credible range, etc., and can obtain results faster without affecting the PCR effect.
Features
■ Highly sensitive antibody modified polymerase can shorten the reaction time by half.
■ The H-Competitor competes with hydrogen bond, which ensures higher amplification efficiency of templates with high GC content, complex secondary structure and long templates.
■ EP component stabilizes PCR system, effectively protects enzyme activity and resists interference of various inhibitors.
■ Colorless transparent tube replaces brown tube, so that the remaining amount is visible.
Applications
It is suitable for expression analysis, nucleic acid detection and other types of experiments on various real time PCR instruments by SYBR Green method, especially for high GC, complex secondary structure, high impurity residue and long template quantification.
Talent qPCR PreMix (SYBR Green) Tiangen GFP209 Publication
- Effects of soybean oil exposure on the survival, reproduction, biochemical responses, and gut microbiome of the earthworm Eisenia fetida.Journal of environmental sciences (China)2023-07-17 Read ArticleAbstract: With increasing production of kitchen waste; cooking oil gradually enters the soil; where it can negatively affect soil fauna.. In this study; we explored the effects of soybean oil on the survival; growth; reproduction; tissue structure; biochemical responses; mRNA expression; and gut microbiome of earthworms ( Eisenia fetida ).. The median lethal concentration of soybean oil was found to be 15.59%.
- A newly identified small tRNA fragment reveals the regulation of different wool types and oxidative stress in lambsScientific Reports2023-06-23 Read Article.. ??L reverse primer: CGTACCCGGTCCTTTACTTG; 10 ??L qPCR PreMix (TIANGEN; FP209-01; China); 8 ??L ddH2O.
and more..
Talent qPCR PreMix (SYBR Green) Tiangen GFP209
All trademarks or registered trademarks appearing on this website are the property of their respective owners.
This product is for scientific research use only. Do not use in medicine, clinical treatment, food or cosmetics.
Need more info ? Contact us anytime. We’re here: Go2biotech
E-mail: maggie@go2biotech.com / morgan@go2biotech.com
Telephone:+86 755 8399 5017
